Developing an Eye for Accuracy Reviews

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Great course. Really helpful techniques that I will use in my own work.

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Would've preferred something that was a bit more about mindset

Found the course very good and helpful.

Very informative - I learnt a lot

Brilliant taught and equally interactive/challenging

Thought it was good but too much of an emphasis on time - so much so that it seemed to turn into a competition with people just trying to get finished the fastest. This is because every excercise was timed

Enjoyed the interactive nature of the course and the progression with activities to show how we’re getting better.