Sort by:

Developing an Eye for Accuracy Reviews

Showing 4 star reviews : View all 589 reviews

Jakub Z, 24 May 2023

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Helpful review?   Yes   No

[ Inappropriate review ]

Damian K, 24 May 2023

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Helpful review?   Yes   No

[ Inappropriate review ]

Debbie U, 18 May 2023

Great course. Really helpful techniques that I will use in my own work.

Helpful review?   Yes   No

[ Inappropriate review ]

Dylan B, 18 May 2023

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Helpful review?   Yes   No

[ Inappropriate review ]

Matt L, 17 May 2023

Would've preferred something that was a bit more about mindset

Helpful review?   Yes   No

[ Inappropriate review ]

Debbie M, 09 Mar 2023

Found the course very good and helpful.

Helpful review?   Yes   No

[ Inappropriate review ]

Alexander P, 23 Feb 2023

Very informative - I learnt a lot

Helpful review?   Yes   No

[ Inappropriate review ]

Connor C, 29 Nov 2022

Brilliant taught and equally interactive/challenging

Helpful review?   Yes   No

[ Inappropriate review ]

Angus A, 29 Nov 2022

Thought it was good but too much of an emphasis on time - so much so that it seemed to turn into a competition with people just trying to get finished the fastest. This is because every excercise was timed

Helpful review?   Yes   No

[ Inappropriate review ]

Mark E, 29 Nov 2022

Enjoyed the interactive nature of the course and the progression with activities to show how we’re getting better.

Helpful review?   Yes   No

[ Inappropriate review ]