Lucy K, 05 Jul 2023
Very engaging trainer, overall good workshop
Zara-ann M, 05 Jul 2023
I have completed this course before in another work place and found the errors i was making to be similar.
Andrew M, 30 Jun 2023
Great engaging trainer. Material was very interesting and definitely introduced a few new concepts. Hopefully will help reduce mistakes during my transfer of information and data.
Tiffany C, 30 Jun 2023
Course was really interesting and taught different ways to process data and improve accuracy and productivity. Although it was virtual, I feel this would have been better delivered in person rather than teams, due to the nature of the checking done within the job,
Richard J, 27 Jun 2023
This was a beneficial practical course for our industry. I feel that going into a bit more detail about the techniques used to maintain concentration / time management may benefit - for example; the Pomodoro technique
Chibesa D, 21 Jun 2023
Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role
Jessica L, 26 May 2023
Good course, very helpful tools, First day felt quite repetitive
Rose C, 24 May 2023
It was a good course but very repetitive and long
Jakub Z, 24 May 2023
I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).