Developing an Eye for Accuracy Reviews

It was a good course but very repetitive and long

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Great course. Really helpful techniques that I will use in my own work.

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Would've preferred something that was a bit more about mindset

Found the course very good and helpful.

Very informative - I learnt a lot

Brilliant taught and equally interactive/challenging

Thought it was good but too much of an emphasis on time - so much so that it seemed to turn into a competition with people just trying to get finished the fastest. This is because every excercise was timed