Developing an Eye for Accuracy reviews

4.7 (692 reviews)
AI summary of reviews

Attendees particularly value the practical accuracy techniques, including clustering, focused checking, regular breaks and recognising personal error patterns. They describe the sessions as interactive and engaging, with varied exercises, assessments and useful materials that reveal how easily mistakes occur. Trainers are praised for their knowledge, clarity, patience and ability to involve everyone. Attendees say the learning improves concentration and confidence and transfers directly to daily work, although some find the sessions lengthy and repetitive.

Practical techniquesInteractive exercisesEngaging trainers

Generated from recent reviews; may not reflect every review

Showing 371–380 of 745 reviews

Sort by

Karen was really nice and very welcoming. She made me feel comfortable even though i had anxiety about coming.

Afia B · 26 May 2023
Helpful review?YesNo
Report review

Practical tips, hints and methods to use to improve accuracy. Course material and exercises well thought out. Course engaging and intense at times. Course instructor’s knowledge, friendly and patient. Overall enjoyed the course.

Navid A · 26 May 2023
Helpful review?YesNo
Report review

Good course, very helpful tools, First day felt quite repetitive

Jessica L · 26 May 2023
Helpful review?YesNo
Report review

Really enjoyable course. Karen kept it fun and upbeat even whilst we were attempting to scribble down 15 digits! She was warm and inclusive which made for an engaging course. I will definitely use the skills learnt going forward

Samantha S · 24 May 2023
Helpful review?YesNo
Report review

A good well thought through course workman like but enjoyed it

Andrew R · 24 May 2023
Helpful review?YesNo
Report review

Really enjoyed the course. Techniques were useful and used throughout the workshop and I saw an improvement as the course progressed.

Joanne D · 24 May 2023
Helpful review?YesNo
Report review

Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.

Sam G · 24 May 2023
Helpful review?YesNo
Report review

Greg was really interactive and made the course as interesting as could be!

Humna A · 24 May 2023
Helpful review?YesNo
Report review

It was a good course but very repetitive and long

Rose C · 24 May 2023
Helpful review?YesNo
Report review

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Jakub Z · 24 May 2023
Helpful review?YesNo
Report review