Sort by:

Developing an Eye for Accuracy Reviews

Andrew R, 24 May 2023

A good well thought through course workman like but enjoyed it

Helpful review?   Yes   No

[ Inappropriate review ]

Joanne D, 24 May 2023

Really enjoyed the course. Techniques were useful and used throughout the workshop and I saw an improvement as the course progressed.

Helpful review?   Yes   No

[ Inappropriate review ]

Sam G, 24 May 2023

Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.

Helpful review?   Yes   No

[ Inappropriate review ]

Humna A, 24 May 2023

Greg was really interactive and made the course as interesting as could be!

Helpful review?   Yes   No

[ Inappropriate review ]

Rose C, 24 May 2023

It was a good course but very repetitive and long

Helpful review?   Yes   No

[ Inappropriate review ]

Jakub Z, 24 May 2023

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Helpful review?   Yes   No

[ Inappropriate review ]

Damian K, 24 May 2023

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Helpful review?   Yes   No

[ Inappropriate review ]

Asha K, 18 May 2023

Really impressed with what I have taken away and learned about myself during the course. This course has supported the nature of work we do and different ways to identify how we can work. Also Greg has a great way of relating to things we discussed so thank you Greg!

Helpful review?   Yes   No

[ Inappropriate review ]

Rebekah W, 18 May 2023

Really good training session, insightful and will help us all in the line of work we do.

Helpful review?   Yes   No

[ Inappropriate review ]

B O, 18 May 2023

Super fun and informative!

Helpful review?   Yes   No

[ Inappropriate review ]