Developing an Eye for Accuracy Reviews

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Really impressed with what I have taken away and learned about myself during the course. This course has supported the nature of work we do and different ways to identify how we can work. Also Greg has a great way of relating to things we discussed so thank you Greg!

Really good training session, insightful and will help us all in the line of work we do.

Super fun and informative!

Wonderful course, and Liz was super. I've learnt a lot on how to better myself in my role.

Liz was really passionate and engaging, she made the course very interactive, was never bored and I honestly found the course very useful. Highly recommend

Great course. Really helpful techniques that I will use in my own work.

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Very interesting & helpful. Greg was very engaging, interactive & made it very fun. He was very clear with explaining everything & ensuring that everyone understood the tasks/learning goals.