Sort by:
Developing an Eye for Accuracy Reviews
Sam G, 24 May 2023
Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.
Humna A, 24 May 2023
Greg was really interactive and made the course as interesting as could be!
Rose C, 24 May 2023
It was a good course but very repetitive and long
Jakub Z, 24 May 2023
I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).
Damian K, 24 May 2023
Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.
Asha K, 18 May 2023
Really impressed with what I have taken away and learned about myself during the course. This course has supported the nature of work we do and different ways to identify how we can work. Also Greg has a great way of relating to things we discussed so thank you Greg!
Rebekah W, 18 May 2023
Really good training session, insightful and will help us all in the line of work we do.
Blue C, 18 May 2023
Wonderful course, and Liz was super. I've learnt a lot on how to better myself in my role.
Bianca A, 18 May 2023
Liz was really passionate and engaging, she made the course very interactive, was never bored and I honestly found the course very useful. Highly recommend