Sort by:

The Accuracy People Reviews

Showing 4 star reviews : View all 987 reviews

Andrew M, 30 Jun 2023

Great engaging trainer. Material was very interesting and definitely introduced a few new concepts. Hopefully will help reduce mistakes during my transfer of information and data.

Helpful review?   Yes   No

[ Inappropriate review ]

Tiffany C, 30 Jun 2023

Course was really interesting and taught different ways to process data and improve accuracy and productivity. Although it was virtual, I feel this would have been better delivered in person rather than teams, due to the nature of the checking done within the job,

Helpful review?   Yes   No

[ Inappropriate review ]

Laura D, 27 Jun 2023

The course was good.

Helpful review?   Yes   No

[ Inappropriate review ]

Richard J, 27 Jun 2023

This was a beneficial practical course for our industry. I feel that going into a bit more detail about the techniques used to maintain concentration / time management may benefit - for example; the Pomodoro technique

Helpful review?   Yes   No

[ Inappropriate review ]

Chibesa D, 21 Jun 2023

Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role

Helpful review?   Yes   No

[ Inappropriate review ]

Jessica L, 26 May 2023

Good course, very helpful tools, First day felt quite repetitive

Helpful review?   Yes   No

[ Inappropriate review ]

Phoebe N, 24 May 2023

I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.

Helpful review?   Yes   No

[ Inappropriate review ]

Rose C, 24 May 2023

It was a good course but very repetitive and long

Helpful review?   Yes   No

[ Inappropriate review ]

Jakub Z, 24 May 2023

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Helpful review?   Yes   No

[ Inappropriate review ]

Damian K, 24 May 2023

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Helpful review?   Yes   No

[ Inappropriate review ]