/reviews/provider/371The Accuracy People - 4 star reviews - page 7
Sort by:

The Accuracy People Reviews

Showing 4 star reviews : View all 934 reviews

Chibesa D, 21 Jun 2023

Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role

Helpful review?   Yes   No

[ Inappropriate review ]

Jessica L, 26 May 2023

Good course, very helpful tools, First day felt quite repetitive

Helpful review?   Yes   No

[ Inappropriate review ]

Phoebe N, 24 May 2023

I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.

Helpful review?   Yes   No

[ Inappropriate review ]

Rose C, 24 May 2023

It was a good course but very repetitive and long

Helpful review?   Yes   No

[ Inappropriate review ]

Jakub Z, 24 May 2023

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Helpful review?   Yes   No

[ Inappropriate review ]

Damian K, 24 May 2023

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Helpful review?   Yes   No

[ Inappropriate review ]

Debbie U, 18 May 2023

Great course. Really helpful techniques that I will use in my own work.

Helpful review?   Yes   No

[ Inappropriate review ]

Dylan B, 18 May 2023

The course was very informative and has taught me lots of new techniques in which i can use to help with my day to day work

Helpful review?   Yes   No

[ Inappropriate review ]

Matt L, 17 May 2023

Would've preferred something that was a bit more about mindset

Helpful review?   Yes   No

[ Inappropriate review ]

Chris M, 27 Apr 2023

The course has taught me a lot on how to reduce written errors. Some of the topics discussed I would not have even considered and it opened my eyes to how many potential errors could be made.

Helpful review?   Yes   No

[ Inappropriate review ]