The Accuracy People Reviews

Course was really interesting and taught different ways to process data and improve accuracy and productivity. Although it was virtual, I feel this would have been better delivered in person rather than teams, due to the nature of the checking done within the job,

The course was good.

This was a beneficial practical course for our industry. I feel that going into a bit more detail about the techniques used to maintain concentration / time management may benefit - for example; the Pomodoro technique

Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role

Good course, very helpful tools, First day felt quite repetitive

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

It was a good course but very repetitive and long

I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.

Great course. Really helpful techniques that I will use in my own work.