The Accuracy People reviews

4.7 (1,044 reviews)
AI summary of reviews

Its trainers make the demanding subject of accuracy feel engaging and approachable, using humour, clear explanations and a supportive atmosphere to involve everyone. Attendees value the practical exercises, mini-assessments, group work and memorable techniques for checking data, written communication, concentration and workload. They say the learning is well structured, supported by useful materials and breaks, and readily applied to everyday work to reduce errors and improve confidence. Some find the sessions longer or more repetitive than necessary.

Engaging trainersPractical techniquesWorkplace application

Generated from recent reviews; may not reflect every review

Showing 71–80 of 236 reviews (4 star)

Sort by

Ok but too long

Caroline H · 20 Jul 2023
Helpful review?YesNo
Report review

Very engaging trainer, overall good workshop

Lucy K · 05 Jul 2023
Helpful review?YesNo
Report review

I have completed this course before in another work place and found the errors i was making to be similar.

Zara-ann M · 05 Jul 2023
Helpful review?YesNo
Report review

Great engaging trainer. Material was very interesting and definitely introduced a few new concepts. Hopefully will help reduce mistakes during my transfer of information and data.

Andrew M · 30 Jun 2023
Helpful review?YesNo
Report review

Course was really interesting and taught different ways to process data and improve accuracy and productivity. Although it was virtual, I feel this would have been better delivered in person rather than teams, due to the nature of the checking done within the job,

Tiffany C · 30 Jun 2023
Helpful review?YesNo
Report review

The course was good.

Laura D · 27 Jun 2023
Helpful review?YesNo
Report review

This was a beneficial practical course for our industry. I feel that going into a bit more detail about the techniques used to maintain concentration / time management may benefit - for example; the Pomodoro technique

Richard J · 27 Jun 2023
Helpful review?YesNo
Report review

Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role

Chibesa D · 21 Jun 2023
Helpful review?YesNo
Report review

Good course, very helpful tools, First day felt quite repetitive

Jessica L · 26 May 2023
Helpful review?YesNo
Report review

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Jakub Z · 24 May 2023
Helpful review?YesNo
Report review