Showing 71–80 of 236 reviews (4 star)
I have completed this course before in another work place and found the errors i was making to be similar.
Great engaging trainer. Material was very interesting and definitely introduced a few new concepts. Hopefully will help reduce mistakes during my transfer of information and data.
Course was really interesting and taught different ways to process data and improve accuracy and productivity. Although it was virtual, I feel this would have been better delivered in person rather than teams, due to the nature of the checking done within the job,
This was a beneficial practical course for our industry. I feel that going into a bit more detail about the techniques used to maintain concentration / time management may benefit - for example; the Pomodoro technique
Overall session was really engaging and informative. The tips and guidance was helpful and applicable to my role
Good course, very helpful tools, First day felt quite repetitive
I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).