Showing 551–560 of 1,118 reviews
A good well thought through course workman like but enjoyed it
The course structure and content was excellent.
Liz brought the topics to life with her examples.
I enjoyed this training, Liz was very interactive with us and super friendly.
Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.
Greg was really interactive and made the course as interesting as could be!
I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).
Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.
It was a good course but very repetitive and long
I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.