Sort by:

The Accuracy People Reviews

Jakub Z, 24 May 2023

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).

Helpful review?   Yes   No

[ Inappropriate review ]

Damian K, 24 May 2023

Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.

Helpful review?   Yes   No

[ Inappropriate review ]

Rose C, 24 May 2023

It was a good course but very repetitive and long

Helpful review?   Yes   No

[ Inappropriate review ]

Phoebe N, 24 May 2023

I thoroughly enjoyed the first session and found it very useful for my work as a legal associate.

Helpful review?   Yes   No

[ Inappropriate review ]

Rebekah W, 18 May 2023

Really good training session, insightful and will help us all in the line of work we do.

Helpful review?   Yes   No

[ Inappropriate review ]

Blue C, 18 May 2023

Wonderful course, and Liz was super. I've learnt a lot on how to better myself in my role.

Helpful review?   Yes   No

[ Inappropriate review ]

Bianca A, 18 May 2023

Liz was really passionate and engaging, she made the course very interactive, was never bored and I honestly found the course very useful. Highly recommend

Helpful review?   Yes   No

[ Inappropriate review ]

Asha K, 18 May 2023

Really impressed with what I have taken away and learned about myself during the course. This course has supported the nature of work we do and different ways to identify how we can work. Also Greg has a great way of relating to things we discussed so thank you Greg!

Helpful review?   Yes   No

[ Inappropriate review ]

B O, 18 May 2023

Super fun and informative!

Helpful review?   Yes   No

[ Inappropriate review ]

Kathryn T, 18 May 2023

Liz was so friendly and nice!

Helpful review?   Yes   No

[ Inappropriate review ]