Sort by:
The Accuracy People Reviews
Joanne D, 24 May 2023
Really enjoyed the course. Techniques were useful and used throughout the workshop and I saw an improvement as the course progressed.
Samantha S, 24 May 2023
Really enjoyable course. Karen kept it fun and upbeat even whilst we were attempting to scribble down 15 digits! She was warm and inclusive which made for an engaging course. I will definitely use the skills learnt going forward
Andrew R, 24 May 2023
A good well thought through course workman like but enjoyed it
Faheem P, 24 May 2023
The course structure and content was excellent.
Faye H, 24 May 2023
Liz brought the topics to life with her examples.
Farhana B, 24 May 2023
I enjoyed this training, Liz was very interactive with us and super friendly.
Sam G, 24 May 2023
Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.
Humna A, 24 May 2023
Greg was really interactive and made the course as interesting as could be!
Jakub Z, 24 May 2023
I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).
Damian K, 24 May 2023
Excellent course overall. A reminder of things that we already know, whilst adding useful strategies to help us improve.