The Accuracy People Reviews

Good course, very helpful tools, First day felt quite repetitive

Really enjoyed the course. Techniques were useful and used throughout the workshop and I saw an improvement as the course progressed.

Really enjoyable course. Karen kept it fun and upbeat even whilst we were attempting to scribble down 15 digits! She was warm and inclusive which made for an engaging course. I will definitely use the skills learnt going forward

A good well thought through course workman like but enjoyed it

The course structure and content was excellent.

Liz brought the topics to life with her examples.

I enjoyed this training, Liz was very interactive with us and super friendly.

Really fun and engaging exercises, could do with a little more time for the ergo breaks but other than that, a lot of fun. :) Greg was a great trainer, very friendly.

Greg was really interactive and made the course as interesting as could be!

I found this course quite interesting, but not as challenging as I was expecting it to be. Maybe more foreign words would pose more challenge, or long sequences of random numbers ( for example DNA team might need to deal with genetic sequences such as AATTAGGCCCCGGATCCCAG).